Northern blotting depends on the phenomenon of the binding of a labeled DNA segment to an mRNA.
Question:
Northern blotting depends on the phenomenon of the binding of a labeled DNA segment to an mRNA. Explain why this binding occurs.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 0% (2 reviews)
The statement in the question about Northern blotting using a labeled DNA segment to bind to mRNA is ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Question Posted:
Students also viewed these Sciences questions
-
Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...
-
Chapter 20 describes a blotting method known as Northern blotting, which can be used to detect RNA transcribed from a particular gene or a particular operon. In this method, a specific RNA is...
-
Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 20, Northern blotting...
-
Casey Motors recently reported the following information: Net income = $850,000. Tax rate = 40%. Interest expense = $200,000. Total investor-supplied operating capital employed = $9 million. ...
-
Refer to the accompanying figure showing surge protectors p and q used to protect an expensive television. If there is a surge in the voltage, the surge protector reduces it to a safe level. Assume...
-
P24-2A Refer to Cellular Technologies. Problem 24-1A. The company sold 11.000 units dur- ing October 20X4. and its actual operating income was as follows: CELLULAR TECHNOLOGIES Income Statement...
-
Explicar cmo llevan a acciones de marketing la tecnologa de la informacin y la extraccin de datos .
-
On December 1, 2016, Lynch Incorporated sold $18,000 of merchandise with terms 2/10, n/EOM. On December 11, 2016, collections were made on sales originally billed for $12,000, and on December 31,...
-
Debra and Merina sell electronic equipment and supplies through their partnership. They wish to expand their computer lines and decide to admit Wayne to the partnership. Debras capital is $200,000,...
-
In Northern and Western blotting, what is the purpose of gel electrophoresis?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Litigation against auditors under the Competition and Consumer Act 2010: A. Does not require the negligence factors of foreseeability and proximity. B. Under section 52 requires professional service...
-
Shire Company's predetermined overhead rate is based on direct labor cost. Management estimates the company will incur $649,000 of overhead costs and $590,000 of direct labor cost for the period....
-
You plan to live 25 years after you retire. You want to withdraw $100,000 each year for 25 years. Your first withdrawal will take place the day after you retire. What is the four annuity formulas...
-
Harwood Company's quality cost report is to be based on the following data: 2021 2022 Depreciation of test equipment $94,000 $95,000 Audits of the effectiveness of the quality system $54,000 $51,000...
-
Cash contribution of 4,000 to the Accounting Society (a charity) Purchase of art object at an Accounting Society Charitable event for $1,200 (FMV $800) Donation of 3-year-old clothing (basis 800; FMV...
-
The government is issuing $100 million in 10 year debt and receives the following bids. $25 million is reserved for non-competitive tenders. At what yield will the non-competitive tenders be issued...
-
The following transactions occurred during the month of April for Nelson Company: a. Purchased materials costing $4,610 on account. b. Requisitioned materials totaling $4,800 for use in production,...
-
The packaging division of a company having considered several alternative package designs for the company's new product has finally brought down their choices to two designs of which only one has to...
-
QUESTION 3 A business owns seven flats rented out to staff at R500 per month. All flats were tenanted Ist january 21 months rent was in arrears and as at 31st December 14 months' rent wa Identify the...
-
1. 2. 3. Select the Tables sheet, select cells A6:B10, and create range names using the Create from Selection button [Formulas tab, Defined Names group]. Select cells B1:F2 and click the Name box....
-
Tropical Rainwear issues 3,000 shares of its $18 par value preferred stock for cash at $20 per share. Record the issuance of the preferred shares. (If no entry is required for a particular...
Study smarter with the SolutionInn App