RNA polymerase transcribes DNA into mRNA by matching base pairs of nucleotides. Which of the following would

Question:

RNA polymerase transcribes DNA into mRNA by matching base pairs of nucleotides. Which of the following would be the segment of DNA on the coding strand corresponding to bases 0-6 in Figure 1?

(A) 5' AAUGCA 3'

(B) 5' TTACGT 3'

(C) 3' AATGCA 5'

(D) 3' TTUGCT 5'


A certain gene has been identified on chromosome 2 in a species of butterfly. The mRNA transcript has been found to be 1578 base pairs in length. A portion of the transcript is shown below. The area shown in grey is part of a known ribosome binding site.5' UUACGUGCAUGCGUAGCUAGCUAGCUAUGCUAUCGCUUUAAGAGCAAAAAA 3' 15 30 45

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For  book-img-for-question
Question Posted: