The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved

Question:

The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved with trypsin with chymotrypsin?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Organic Chemistry

ISBN: 9780495112587

7 Edition

Authors: John McMurry

See More Books

Question Posted: Mar 08, 2011 05:48 AM

See More Questions

Angiotensin II is an octapeptide with vasoconstrictor activity. Complete hydrolysis gives one equivalent each of Arg, Asp, His, Ile, Phe, Pro, Tyr, and Val. Reaction with Sanger's reagent gives,...
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe that the DNA contained a transposable element?
Design a disc brake with a double caliper. Each side of the disc has two 40-mm-diameter pads. The center of the brake pads is at a radius of 150 mm. The outside diameter of the disk is 360 mm. The...
If your social media monitoring efforts pick up a tweet that accuses your customer service staff of lying and claims to have evidence to back it up, how would you respond?
From the interest tables in Appendix B, determine the value of the following factors by interpolation, and compare the results with those obtained from evaluating the A/P and P/A interest formulas:...
1. Summarize Mark's view of the computer industry. Is there merit to his argument? Why or why not?
You are the chief financial officer of a large multinational company, and six months from now you will be receiving a settlement payment of $50 million, which you plan to invest in 10-year U.S....
Milano Pizza is a small neighborhood pizzeria that has a small area for in-store dining as well as offering take-out and free home delivery services. The pizzeria's owner has determined that the shop...
Use the SMOKE for this question. The variable cigs is the number of cigarettes smoked per day. How many people in the sample do not smoke at all? What fraction of people claim to smoke 20 cigarettes...
Show the structures of the products obtained on reaction of valine with ninhydrin.
What is the N-terminal residue on a peptide that gives the following PTH derivative on Edmandegradation?
In 2018, Mastercard Incorporated had a market capitalization of $200 billion, debt of $6.5 billion, cash of $8.2 billion, and EBIT of over $7 billion. If Mastercard were to increase its debt by $1...
An important first step of exploratory data analysis is always to visualize the data. Construct a scatterplot of each time series (i.e., two different plots). If you need pointers on how to make a...
Cleanie Wombat Cleanie Wombat is a small Australian company that makes cleaning products. The chemical formulas used for its products were developed through R&D conducted by the company's small R&D...
As a manager at Yummy Melts, Martin is responsible for the firm's Just Right brand of ice cream. He recently approved a proposal to test market new ice cream flavors. He is also considering the...
Cogenesis Corporation is replacing their current steam plant with a 6-megawatt cogeneration plant that will produce both steam and electric power for their operations. What is the impact of a 5% and...
Suppose ABC firm is considering an investment that would extend the life of one of its facilities for 5 years. The project would require upfront costs of $9.97M plus $28.94M investment in equipment....
As a business professional, it is likely information systems professionals will ask you data questions like those in questions 1-11 to 1-13. What is the best way for you to respond? Verbally in a...
A copper wire (density = 8.96 g/cm 3 ) has a diameter of 0.25 mm. If a sample of this copper wire has a mass of 22 g, how long is the wire?
Carbon dioxide dissolves in water according to the equations: Carbon dioxide levels in the atmosphere have increased about 20% over the last century. Given that Earths oceans are exposed to...
How many hydrogens are replaced by deuterium when each of the following compounds is treated with NaOD in D2O? a. 3-methylcyclopentanone b. 3-methylhexanal
As described in "A Word About . . . Water Treatment and the Chemistry of Enols/Enolates," carbonyl compounds can become halogenated by treatment with a base and a halogen source, such as Cl2....
Write out the steps in the mechanism for the aldol condensation of butanal (the first step in the synthesis of the mosquito repellent "6-12," eq. 9.57).
Aecerty 1067687 was completed with the folowing charaderistick Murulectere sec00 5xs:99 s35ida sputed
Assume todays settlement price on a CME EUR futures contract is $1.3180 per euro. You have a long position in one contract. EUR125,000 is the contract size of one EUR contract. Your performance bond...
Q2. Company ABC bought an equipment for $20,000 in 2015, with useful life of 5 years $5,000 residual value amortized using straight-line method. Prepare a table to illustrate the differences...

The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved

Question:

Step by Step Answer:

Trypsin cleaves peptide bonds at the carboxyl side of ...View the full answer

Organic Chemistry

Students also viewed these Organic Chemistry questions