Question: You are performing site-directed mutagenesis to test predictions about which residues are essential for a protein's function. Which of each pair of amino acid substitutions

You are performing site-directed mutagenesis to test predictions about which residues are essential for a protein's function. Which of each pair of amino acid substitutions listed below would you expect to disrupt protein structure the most? Explain.
(a) Val replaced by Ala or Phe.
(b) Lys replaced by Asp or Arg.
(c) Gln replaced by Glu or Asn.
(d) Pro replaced by His or Gly.

Step by Step Solution

★★★★★

3.66 Rating (164 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

a Phe Ala and Phe are both hydrophobic but Phe is much larger and might not fit as well in V... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

930-M-S-B-C (1106).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

Which amino acid substitutions might occur in E. coli opal suppressors that arise by singlebase mutations?

Which acid of each pair shown here would you expect to be stronger? (a) (b) (c) (d) (e) HO HO 10 HO HO 3 10 F O or OH OH or MeJN OH OH or CF

The different substrate specificities of chymotrypsin and trypsin have been attributed to the presence of different amino acid residues in the binding pocket. What problems can arise when...

Question 7: Draw a correlation plot showing all pairwise associations among the following variables: "attend", "termGPA", "priGPA" and "ACT". Next, add the variables "final" ,"atndrte" and "hwrte" to...

In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish to change a putative active site histidine residue to a proline by site-directed mutagenesis. The...

Site-directed mutagenesis is used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid...

Site-directed mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino...

A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...

Identify which of the following are examples of reverse genetics. RNA interference gene knockout using site-directed mutagenesis mutation from wildtype allele to mutant allele DNA microarray mutation...

Let's suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response...

1) The switch in the circuit below closes at t= 0 seconds. At the 200 milli-second point the switch opens. Sketch the voltage on the capacitor as a function of time to 400 milli-seconds. Clearly...

What role does the organizational culture and climate play in a rapidly growing venture?

In a hostile takeover, a firm can offer a price for company stock that is less than market value and less than the value shareholders approve.

Consider the data and simple linear regression model in Exercise 6-2. (a) Find the mean pounds of steam given that the ambient temperature is 52 degrees. (b) Compute a 99% CI on this mean response....

What is the pK of the weak acid HA if a solution containing 0.1 M HA and 0.2 M A- has a pH of 6.5?

How many grams of sodium succinate (formula weight 140 g mol-1) and disodium succinate (formula weight 162 g mol-1) must be added to 1 L of water to produce a solution with pH 6.0 and a total solute...

Estimate the volume of a solution of 5 M NaOH that must be added to adjust the pH from 4 to 9 in 100 mL of a 100 mM solution of phosphoric acid.

A portfolio contains: 77 shares of stock A that sells for $68 per share with an expected return of 12.5% - 46 shares of Stock B that sells for $52 per share with an expected return of 8.75% What is...

1 . 7.56 Who Is More Likely to Take Vitamins: Males or Females? Data 2.11 introduces the dataset NutritionStudy which contains, among other things, information about vitamin use and gender of the...

Which of the following statements concerning the estimation of bad debt expense using the percentage-of-credit-sales method is correct? It causes an adjustment to the allowance account based on the...