Figure 7.9. Draw a growth curve for a psychrotroph on the following diagram. | Psychrophile Mesophile Thermophile
Question:
Transcribed Image Text:
| Psychrophile Mesophile Thermophile Optimum Minimum Maximum -15-10 50 5 10 1520253035 4045505560 8570 75 808590 Temperature C
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 61% (13 reviews)
The curve for a psychrotroph would slowly incr...View the full answer
Answered By
JAPHETH KOGEI
Hi there. I'm here to assist you to score the highest marks on your assignments and homework. My areas of specialisation are:
Auditing, Financial Accounting, Macroeconomics, Monetary-economics, Business-administration, Advanced-accounting, Corporate Finance, Professional-accounting-ethics, Corporate governance, Financial-risk-analysis, Financial-budgeting, Corporate-social-responsibility, Statistics, Business management, logic, Critical thinking,
So, I look forward to helping you solve your academic problem.
I enjoy teaching and tutoring university and high school students. During my free time, I also read books on motivation, leadership, comedy, emotional intelligence, critical thinking, nature, human nature, innovation, persuasion, performance, negotiations, goals, power, time management, wealth, debates, sales, and finance. Additionally, I am a panellist on an FM radio program on Sunday mornings where we discuss current affairs.
I travel three times a year either to the USA, Europe and around Africa.
As a university student in the USA, I enjoyed interacting with people from different cultures and ethnic groups. Together with friends, we travelled widely in the USA and in Europe (UK, France, Denmark, Germany, Turkey, etc).
So, I look forward to tutoring you. I believe that it will be exciting to meet them.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Foundations in Microbiology
ISBN: 978-0073375298
8th edition
Authors: Kathleen Park Talaro, Barry Chess
Question Posted:
Students also viewed these Biology questions
-
Draw a diagram similar to Figure 4.4 for a two-way factorial design with four levels of the first factor, three levels of the second factor, and two observations per factor-level combination in...
-
Draw a Venn diagram like that in Figure 10 that expands the general addition rule to three events. Use the diagram to write the General Addition Rule for three events.
-
Draw a diagram similar to that of Figure that shows the sequence events for this same example using priority ceiling. s locked Blocked by T3 by T (attempt to lock s) s unlocked T1 T2 s locked...
-
Assume a retailer has fixed costs of $10,000, a unitvariable cost of $25, and a 50% retail margin. How many units must be sold for her tobreak-even? If she has a target profit of $200,000, how many...
-
Draw a figure similar to Figure 6.1, showing how mutually beneficial trade can take place between two nations based on economies of scale if the nations have identical production frontiers but...
-
Tuscarora, Inc., a merchandising company, has the following budgeted figures: Feb $64,000 Mar $88,000 April $92,000 Sales Cost of goods sold Jan $56,700 60% of sales $10,000 + 30% of next month's...
-
Explicar formas alternas de clasificar los establecimientos detallistas . OA3
-
On January 1, 2019, Parker, Inc., a U.S.-based firm, acquired 100 percent of Suffolk PLC located in Great Britain for consideration paid of 52,000,000 British pounds (), which was equal to fair...
-
The following information is available to reconcile Branch Company's book balance of cash with its bank statement cash balance as of July 31 a. On July 31, the company's Cash account has a $25,756...
-
1. What are the lambda max values for DNA and colorless proteins in solution? 2. At what wavelength is DNA concentration deyermined? 3. What is the concentration of DNA in a sample if the OD at 260...
-
a. If an egg salad sandwich sitting in a warm car for 4 hours develops 40,960 bacterial cells, how many more cells would result with just one more hour of incubation? Use the same criteria that were...
-
Microorganisms are being developed to control human-made pollutants and oil spills that are metabolic poisons to animal cells. A promising approach has been to genetically engineer bacteria to...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
Will the amount of an accrual always be an exact known amount, or could it be an estimate?
-
The reorder point for SKU 303 is 102 units, while average demand during the lead time on an order for SKU 303 is 97 units. How much safety stock is implied by SKU 303's reorder point policy?
-
Find the volume of the solid obtained by rotating the region bounded by the given curves about the specified line. Sketch the region, the solid and a typical disk or washer. -2x 3. y = ex, y = 0, x =...
-
2. Given the list of scores: Score1 = [ 10, 40, 50, 54, 55, 59, 63, 65, 70, 71, 75, 77, 79, 80, 99] The one-sample T-test is used to test whether the mean of Score1 is statistically different from...
-
Find the area of the triangle having the given measurements. Round to the nearest square unit. 13) C=100, a 3 yards, b = 8 yards Use Heron's formula to find the area of the triangle. Round to the...
-
The auditors for Drawing Heavy Industries, Inc. recently completed an audit of the company-owned store used by its employees and their families. Following are the findings and recommendations...
-
Explain the circumstances that could result in a long-term bank loan being shown in a statement of financial position as a current liability.
-
What are activity and activity coefficient? How does activity coefficient relate to excess property?
-
a. List examples of microbes used in the production of fermented products such as beer, cheese, and pickles. b. Explain why only specific microbes are selected to produce each of these distinct...
-
a. If fermentation of sugars to produce alcohol in wine is anaerobic, why do winemakers make sure that the early phase of yeast growth is aerobic? b. In many cases, the identification of bacteria in...
-
a. Predict the differences in the outcome if raw milk is incubated for 48 hours versus pasteurized milk being incubated for the same length oftime. b. Many soldiers are deployed to areas of the world...
-
ABC Corporation has an activity - based costing system with three activity cost pools - Machining, Setting Up , and Other. The company's overhead costs, which consist of equipment depreciation and...
-
Consolidated Balance Sheets - USD ( $ ) $ in Thousands Dec. 3 1 , 2 0 2 3 Dec. 3 1 , 2 0 2 2 Current assets: Cash and cash equivalents $ 9 8 , 5 0 0 $ 6 3 , 7 6 9 Restricted cash 2 , 5 3 2 Short -...
-
How does corporate governance contribute to investor confidence and stakeholder trust? Accounting
Study smarter with the SolutionInn App