What is the difference in the requirement for a primer in RNA transcription compared to DNA replication?

Question:

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Biochemistry

ISBN: 9781305961135

9th Edition

Authors: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

See More Books

Question Posted: Dec 16, 2023 12:44 AM

See More Questions

What happens in the market for coffee if the price of sugar rises? Select one: a. supply shifts to the left and price b. supply shifts to the right and price decreases c. demand shifts to the left...
In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki...
In eukaryotes, the three RNA polymerases, Pol I, II, and III, each transcribes unique genes required for the synthesis of ribosomes: 25S and 18S rRNAs (Pol 1), 55 rRNA (Pol III), and mRNAs for...
You invested $1000 in Sinoland Bank stock when Sinoland/US Dollar exchange rate was 10:1, and you received exactly 200 local shares of the stock. The stock price rises 23% in local currency terms,...
Edgemont Repairs began operations on January 1, 2010. The 2010, 2011, and 2012 financial statements follow: On January 1, 2012, the company expanded operations by taking out a $40,000 long-term loan...
Show that the real zeros of each polynomial function satisfy the given conditions. (x) = x 4 + x 3 - x 2 + 3; no real zero less than -2
17. Consider AAAPI, the Nikkei ADR in disguise. To answer this question, use the information in Table 4. a. What is the volatility of Y , the price of AAAPI? b. What is the covariance between Y and...
A camera of mass 240 g is mounted on a small tripod of mass 200g, assuming that the mass of the camera is uniformly distributed and that the line of action of the weight of the tripod passes through...
State requested value(s) and discuss your answer State the values for the following operational cost factors using the information given below: Value of capital assets, Direct material cost, Fixed...
What is a factor? Why is it important in transcription?
The malateaspartate shuttle yields about 2.5 moles of ATP for each mole of cytosolic NADH. Why does nature use the glycerolphosphate shuttle, which yields only about 1.5 moles of ATP?
Fill in the blanks with an appropriate word, phrase, or symbol(s). Given the conditional statement p q, the converse of the conditional statement in symbolic form is _________.
Find the best predicted tip for a ride that is 3.10 miles. How does the result compare to the actual tip of $4.55? Find the best predicted fare amount for a distance of 3.10 miles. How does the...
Since the SUTA rates changes are made at the end of each year, the available 2022 rates were used for FUTA and SUTA. Note: For this textbook edition the rate 0.6% was used for the net FUTA tax rate...
I have asked three questions with my textbook chapter in which they come from. it would be greatly appreciated if you could help me answer these three questions. Thanks so much. :) 1. What is the...
From your reading in Stevens & Smith (2010), a basic description of a medical detoxification, dual-diagnosis inpatient hospital, independent rehab programs, partial hospitalization, halfway houses,...
Explain Example 1.4 in terms of maps.
Critical reading SAT scores are distributed as N(500, 100). a. Find the SAT score at the 75th percentile. b. Find the SAT score at the 25th percentile. c. Find the interquartile range for SAT scores....
How many amino acid copolymers can be specified by polynucleotides consisting of two alternating nucleotides? What are the sequences of these polypeptides?
Predict the effect on protein structure and function of an AT to GC transition in the first codon position for lysine?
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Indicate whether the following managerial policy increases the risk of a death spiral:Use of low operating leverage for productionGroup of answer choicesTrueFalse
It is typically inappropriate to include the costs of excess capacity in product prices; instead, it should be written off directly to an expense account.Group of answer choicesTrueFalse
Firms can avoid the death spiral by excluding excess capacity from their activity bases. Group of answer choicesTrueFalse

What is the difference in the requirement for a primer in RNA transcription compared to DNA replication?

Question:

Step by Step Answer:

No primer i...View the full answer

Biochemistry

Students also viewed these Sciences questions