Question: How did the Precambrian atmosphere become nitrogen-enriched?

How did the Precambrian atmosphere become nitrogen-enriched?

Step by Step Solution

★★★★★

3.43 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

During the Archean Earth cooled to the point where water ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Conceptual Physical Science Questions!

Q:

Before entering the atmosphere, where did much of the newly released oxygen end up during the Precambrian?

Q:

The source of oxygen that drives the internal combustion engine in an automobile is air. Air is a mixture of gases, principally N2 (~79%) and O2 (~20%). In the cylinder of an automobile engine,...

Q:

The molar heat capacity of a diatomic molecule is 29.1 J/K mol. Assuming the atmosphere contains only nitrogen gas and there is no heat loss, calculate the total heat intake (in kilojoules) if the...

Q:

The composition of the atmosphere is approximately 80 per cent nitrogen and 20 per cent oxygen by mass. At what height above the surface of the Earth would the atmosphere become 90 per cent nitrogen...

Q:

16. The composition of the atmosphere is approximately 80% nitrogen and 20% oxygen by mass. At what height above the surface of the earth would the atmosphere become 90% nitrogen and 10% oxygen by...

Q:

develop a scaling system to determine if each time unit is accurately represented in terms of the length that has been allocated for it. ERA PERIOD Quaternary # OF METERS EPOCH Recent (Holocene)...

Q:

Having trouble with the calculations, especially the last 4. Any help would be great thanks lods (see table). The Geologic Timescale ERA PERIOD REMARKS Myrs Large ice sheets centered on Earth's...

Q:

1. Evolution of life during the Precambrian Period Most of the major advancements in the development of life on Earth occurred during a time early in Earth's history called the Precambrian Period....

Q:

In this lab, your team will use a calculator tape to represent the history of our planet. You will need a piece of tape long enough to illustrate time from the formation of Earth to the present. Use...

Q:

2/21/2016 A modern ark | The Economist Special report: Climate change Biodiversity A modern ark To save endangered species, move them to more congenial places Nov 28th 2015 | From the print edition...

Q:

8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5' A.) What is the MRNA sequence that would result from transcription of this sequence?...

Q:

The chart below contains the necessary information for a Cournot duopoly with an identical product. You have the market demand, Qd = 60 - 0.5P, so your inverse demand is P = 120-2Qd, and each firm...

Q:

List four crucial things you should do if you want to keep your finances under control, and describe how you can achieve each one.

Q:

What is the importance of a script in radio? Take 3 products that advertise both on radio and television and compare their scripts. Do they tell the same story? What differences do you note?

Q:

Why can it hurt your foot more to kick a big rock than a small pebble? Must the big rock hurt more? Explain.

Q:

(a) An ordinary flea has a mass of 210 g. How many newtons does it weigh? (b) The mass of a typical froghopper is 12.3 mg. How many newtons does it weigh? (c) A house cat typically weighs 45 N. How...

Q:

A person can dive into water from a height of 10 m without injury, but a person who jumps off the roof of a 10-m-tall building and lands on a concrete street is likely to be seriously injured. Why is...

Q:

Fas please, Suppose the current dividends on a stock are $2.8 per share and dividends are expected to increase by 2% per year, forever. If the required rate of return is 8%, what is the value of the...

Q:

You just looked at the Wall Street Journal and found the following list of a corporate bond. How much do you need to pay to purchase each bond

Q:

The following table shows the prices of a sample of Treasury strips. Each strip makes a single payment at maturity. Calculate the interest rate offered by each of these strips. Years to Maturity...