______ carries coded instructions for an amino acid sequence to the ribosome. a.DNA b. RRNA c. MRNA
Question:
______ carries coded instructions for an amino acid sequence to the ribosome.
a. DNA
b. RRNA
c. MRNA
d. TRNA
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (2 reviews)
Answered By
Ajeet Singh
Hi there! Are you looking for a committed, reliable, and enthusiastic tutor? Well, teaching and learning are more of a second nature to me, having been raised by parents who are both teachers. I have done plenty of studying and lots of learning on many exciting and challenging topics. All these experiences have influenced my decision to take on the teaching role in various capacities. As a tutor, I am looking forward to getting to understand your needs and helping you achieve your academic goals. I'm highly flexible and contactable. I am available to work on short notice since I only prefer to work with very small and select groups of students. Areas of interest: Business, accounting, Project management, sociology, technology, computers, English, linguistics, media, philosophy, political science, statistics, data science, Excel, psychology, art, history, health education, gender studies, cultural studies, ethics, religion. I am also decent with math(s) & Programming. If you have a project you think I can take on, please feel welcome to invite me, and I'm going to check it out!
5.00+
4+ Reviews
24+ Question Solved
Related Book For
Question Posted:
Students also viewed these Sciences questions
-
Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
-
To study the function of a gene in detail, you downloaded a piece of genomic sequence for this gene from the NCBI database. 5 - ATGAACACTTCGGAAGGTTGTATCGGTGGTCGATTC - 3 a. (10 pts) Write down the...
-
Consider the following two peptides, which may have been isolated from the floor of a Big Ten basketball arena circa 2000: A: K-E-A-D-Y B: K-N-I-G-H-T (a) Which peptide is more basic (has the higher...
-
A 30-year maturity bond making annual coupon payments with a coupon rate of 12% has duration of 11.54 years and convexity of 192.4. The bond currently sells at a yield to maturity of 8%. Use a...
-
Fabulator, Inc. produces and sells fashion clothing. On July 1, 2012, Fabulator, Inc. issued $120,000,000 of 20-year, 14% bonds at a market (effective) interest rate of 11%, receiving cash of...
-
How could Bill have approached the hiring decision?
-
Icebreaker is considering expansion but is unsure as to whether Brazil or Argentina hold more potential. Explain how you would assess the market potential for each market. lo1
-
The Trade Show Bureau conducted a survey to determine why people go to trade shows. The respondents were asked to rate a series of reasons on a scale from 1 to 5, with 1 representing little...
-
Free cash flow Dillin Inc. reported the following on the company's statement of cash flows in 2012 and 2011: 2012 2011 Net cash flow from operating activities $472,600 $458,000 Net cash flow used for...
-
Name the three classes of RNA and describe their functions.
-
How does RNA differ from DNA?
-
Using the data presented in BE16-5, assume Strand Corp. is a public company and that it purchased Hydrocor's bonds to trade. Prepare the journal entries to record (a) The purchase of the bonds on...
-
1. The KYM company wants to invest $ 523,000 pesos in the bank that guarantees a simple interest rate of 3.32% quarterly. If the company is considering the 8-month investment. What amount will you...
-
3. (5 points) The uncertainty principle limits our ability to determine simultaneously the position and momentum of a particle. (a) Why were classical physicists unaware of the limitations that this...
-
CASE STUDY Patient Name Valarie Ramirez Attending Paul F. Buckwalter, MD PATIENT INFORMATION DOB 08/04/1986 Allergies MAN 00-AA-006 Penicillin Other Information Past HX: AB x1 Valarie Ramirez arrives...
-
Petesy Corporation is preparing its Master Budget for 2019. Budget information is as follows: SalesProduction CostOperating Expenses 20191 st Quarter P280,000P192,000P64,000 2 nd Quarter 320,000...
-
A steady flow of 20 m3/s of moist air at TDB = 35iC, TWB = 25iC, 100 kPa (state 1) is dehumidified by first cooling it and condensing out moisture (state 2), then reheating it to 20iC and 50% R.H....
-
For the following diagram, compute the interest rate at which the costs are equivalent to the benefits. 80 80 80 80 80 200 200 200
-
The 2017 financial statements of the U.S. government are available at: https://www.fiscal.treasury.gov/fsreports/rpt/finrep/fr/fr_index.htm Use these to answer the following questions: a. Statement...
-
Suggest an efficient synthesis for the following transformation: CI H
-
A student gets up from her chair and pushes a stack of books across the table. They fall to the floor. Is the work associated with each part of this process positive, negative, or zero?
-
Why is H sublimation = H fusion + H vaporization ?
-
A stock is expected to pay a dividend of $1.50 at the end of the year (i.e., D 1 = $1.50), and it should continue to grow at a constant rate of 10% a year. If its required return is 14%, what is the...
-
The Hobby Shop has a checking account with a ledger balance of $1,700. The firm has $2,400 in uncollected deposits and $4,200 in outstanding checks. What is the amount of the disbursement float on...
-
An investment will pay you $34,000 in 11 years. If the appropriate discount rate is 6.1 percent compounded daily, what is the present value? (Use 365 days a year. Do not round intermediate...
Study smarter with the SolutionInn App