What amino acid sequence is coded for by the following DNA coding strand? (5) CTT-CGA-CCA-GAC-AGC-TTT (3)
Question:
What amino acid sequence is coded for by the following DNA coding strand?
(5’) CTT-CGA-CCA-GAC-AGC-TTT (3’)
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 84% (13 reviews)
DNA coding strand 53 mRNA 53 Amino acid sequence CTTCGACCAGA...View the full answer
Answered By
Branice Buyengo Ajevi
I have been teaching for the last 5 years which has strengthened my interaction with students of different level.
4.30+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
2- A rigid tank contains 0.5 kg of oxygen (O,) initially at 30 bar and 200 K. The gas is cooled and the pressure drops to 20 bar. Determine the volume of the tank, in m', and the final temperature,...
-
What amino acid sequence is coded for by the following mRNA base sequence? (5) CUA-GAC-CGU-UCC-AAG-UGA (3)
-
What amino acid sequence is coded by the following mRNA base sequence? CUU-AUG-GCU-UGG-CCC-UAA
-
Molly earns a gross yearly salary of $132,676. She has no dependent children and made the following tax deductible purchases: Charitable contributions: $5,401 Student loan interest: $1,429 When she...
-
1. Why did the government and consumers have regulatory opposition to the proposed merger and acquisition to the proposed merger between Comcast and Time Warner? 2. Why would Comcast's partnership...
-
Estimate the average binding energy per nucleon for each of the following nuclei from Figure. 23.11. 1. 48 22 Ti 2. 141 58 Ba 3. 12 6 C 10 8 6 4 0 0 50 100 150 200 250 Number of nucleons, A
-
How can two-way performance mapping assist a manager in understanding the competitive structure of his or her industry?
-
Namath Manufacturing Company manufactures a variety of tools and industrial equipment. The company operates through three divisions. Each division is an investment center. Operating data for the Home...
-
5. (20 pts) The table below lists the values of R = f(p, q) for some quantities p, q P 8 9 10 11 12 9 19 0 4 6 7 20 -2 3 5 6 6 21 -1 4 4 5 22 0 2 5 6 7 Estimate fp(10, 20) and interpret
-
Complete the diagram below, which shows the flux of alanine's amino group from its entry into the liver to its exit as urea. NAD(P) NAD(P)H 2 Alanine 2 -Ketoglutarate 2 ATP HCO,- 2 ADP+2P...
-
Give an mRNA sequence that will code (or the synthesis of angiotensin II. Asp-Arg-Val-Tyr-IIe-His-Pro-Phe
-
If the DNA coding sequence CAA-CCG-GAT- were miscopied during replication and became -CGA-CCG-GAT-, what effect would there he on the sequence of the protein produced?
-
An apartment owner charges rent R proportional to the floor area A of the apartment. Find the equation relating R and A if an apartment of 900 ft 2 rents for $850/month.
-
If a dosage d of a drug is administered to a patient, the amount of the drug remaining in the tissues t hours later will be f(t) = dekt, where k (the "absorption constant") depends on the drug.t For...
-
Why we need marketing plan and marketing action plan in milktea shop business? Explain your learnings. One hundred words and more do not plagiarise
-
What strategies can organizations employ to ensure that diversity and inclusion efforts are not merely symbolic gestures or checkbox exercises, but rather integrated into the fabric of organizational...
-
A technician is tracing airflow through the HVAC module. What component does the air flow through first?
-
Define leverage and explain the meaning of procyclical leverage. Intuitively explain how investment banks can obtain this type of leverage.
-
What steps should firms follow to implement the recommendations listed above?
-
The figure shows a bolted lap joint that uses SAE grade 8 bolts. The members are made of cold-drawn AISI 1040 steel. Find the safe tensile shear load F that can be applied to this connection if the...
-
Ammonia is to be isothermally compressed in a specially designed flow turbine from 1 bar and 100C to 50 bar. If the compression is done reversibly, compute the heat and work flows needed per mole of...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
Write the structure for a. dCMP b. dGMP
-
What products would you expect to obtain from the complete hydrolysis of NAD? See page 547 for its structure.
-
Dave Krug finances a new automobile by paying $ 5 , 6 0 0 cash and agreeing to make 1 0 monthly payments of $ 5 2 0 each, the first payment to be made one month after the purchase. The loan bears...
-
The following financial information is presented for three different companies. Determine the missing amounts.
-
Current Attempt in Progress The stockholders' equity section of Barrel Corporation's balance sheet on Decem ber 3 1 , 2 0 2 6 , appears ballowr Stocktholders equity Paid - in capital \ table [ [ \...
Study smarter with the SolutionInn App