Is myosin a fibrous protein or a globular protein? Explain.
Question:
Is myosin a fibrous protein or a globular protein? Explain.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 71% (7 reviews)
Myosin is a fibrous protein Fibrous proteins are elongated and have a structural role The...View the full answer
Answered By
Deepak Pal
Hi there! Are you looking for a committed, reliable, and enthusiastic tutor? Well, teaching and learning are more of a second nature to me, having been raised by parents who are both teachers. I have done plenty of studying and lots of learning on many exciting and challenging topics. All these experiences have influenced my decision to take on the teaching role in various capacities. As a tutor, I am looking forward to getting to understand your needs and helping you achieve your academic goals. I'm highly flexible and contactable. I am available to work on short notice since I only prefer to work with very small and select groups of students. Areas of interest: Business, accounting, Project management, sociology, technology, computers, English, linguistics, media, philosophy, political science, statistics, data science, Excel, psychology, art, history, health education, gender studies, cultural studies, ethics, religion. I am also decent with math(s) & Programming. If you have a project you think I can take on, please feel welcome to invite me, and I'm going to check it out!
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Fundamentals Of Biochemistry Life At The Molecular Level
ISBN: 9781118918401
5th Edition
Authors: Donald Voet, Judith G Voet, Charlotte W Pratt
Question Posted:
Students also viewed these Sciences questions
-
Myosin Vis an abundant nonmuscle myosin that is responsible for the transport of cargo such as organelles in many cell types. Structurally, it consists of two identical polypeptide chains that...
-
Globular proteins are typically constructed from several layers of secondary structure, with a hydrophobic core and a hydrophilic surface. Is this true for a fibrous protein such as keratin?
-
A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel electrophoresis in the presence of sodium dodecyl sulfate (SDS), the protein gives three bands with...
-
Each of the following passages may be plausibly criticized by some who conclude that it contains a fallacy, but each may be defended by some who deny that the argument is fallacious. Discuss the...
-
What is keystroke monitoring?
-
Q7 Why are XML and other SOA standards important
-
Distribution of yellowhammer birds. An article in the Journal of Animal Ecology (July 2006) discussed some of the caveats of using stepwise regression. An example presented used stepwise regression...
-
Describe the components of the common body of tax law (CBOTL). What role does the U.S. Congress play in creating the tax law? Briefly explain how a tax bill becomes a tax law. What role does the...
-
If a parent company wished to participate in off-balance sheet financing with one of the companies it is invested in, which of the following options can it follow under GAAP?\ Keep their ownership...
-
Rigor mortis, the stiffening of muscles after death, is caused by depletion of cellular ATP. Describe the molecular basis of rigor.
-
The force generated by a muscle fiber increases as the sarcomere shortens but decreases at very short sarcomere lengths. Explain this observation. Force (% max.) 100 75 50 25 0 1 2 3 Sarcomere length...
-
Bell Computers purchases integrated chips at $350 per chip. The holding cost is $35 per unit per year, the ordering cost is $120 per order, and sales are steady, at 400 per month. The companys...
-
Turn this information into an excel sheets with the excel formulas being shown P12.2 (LO 1, 2) (Liability Entries and Adjustments) Listed below are selected transactions of Schultz Department Store...
-
1. Consider an undirected random graph on the set of four vertices {A, B, C, D} such that each of the 4 2 = 6 potential edges exists with probability 0.2, independently of the presence/absence of any...
-
Basic Net Present Value Analysis Jonathan Butler, process engineer, knows that the acceptance of a new process design will depend on its economic feasibility. The new process is designed to improve...
-
Determine the support reactions at the smooth collar A and the normal reaction at the roller support B. 800 N 600 N B 0.8 m 0.4 m 0.4 m 0.8 m
-
A plant hopes to cool a steam line by sending it through a throttling valve to expand it to atmospheric pressure. The steam enters the valve at 550C and 250 bar. The expansion in the valve happens so...
-
The Town of Thomaston has a Solid Waste Landfill Enterprise Fund with the following trial balance as of January 1, 2017, the first day of the fiscal year. During the year, the following transactions...
-
Calculate I, , and a for a 0.0175 m solution of Na 3 PO 4 at 298 K. Assume complete dissociation. How confident are you that your calculated results will agree with experimental results?
-
Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.
-
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
-
Why does promoter efficiency tend to decrease with the number of G C base pairs in the - 10 region of a prokaryotic gene?
-
Physical Units Method, Relative Sales Value Method Farleigh Petroleum, Inc., is a small company that acquires high - grade crude oil from low - volume production wells owned by individuals and small...
-
A proposed $2.5 M investment in new equipment at a 100 MG/y M&Ms factory will save the plant $800,000/y in energy costs. Assuming an annual interest rate of 5%/y (compounded annually), and an...
-
Brief Exercise 10-7 Coronado Company obtained land by issuing 2,250 shares of its $14 par value common stock. The land was recently appraised at $103,240. The common stock is actively traded at $44...
Financial And Operational Risk Management At Molson Coors 1st Edition - ISBN: 0133757390 - Free Book
Study smarter with the SolutionInn App