how to Find Frequent Words with Mismatches and Reverse Complements in python

We now extend Find the Most Frequent Words with Mismatches in a String to find frequent words with both mismatches and reverse complements. Recall that Pattern refers to the reverse complement of Pattern. Frequent Words with Mismatches and Reverse Complements Problem Find the most frequent k-mers (with mismatches and reverse complements) in a DNA string. Given: A DNA string Text as well as integers k and d. Return: All k-mers Pattern maximizing the sum Countd(Text, Pattern) + Countd(Text, Pattern) over all possible k-mers.

Sample Dataset :

ACGTTGCATGTCGCATGATGCATGAGAGCT

4 1