New Semester Started Get 50% OFF Study Help! --h --m --s Claim Now

Question Answers

Textbooks

Find textbooks, questions and answers

Oops, something went wrong!

Change your search query and then try again

Result Not Found

Books FREE
Study Help
Tutors
AI Study Planner NEW
Sell Books

Search
Sign In
Register

study help
subject categories
computer science
programming
december 2021
08

Programming Questions and Answers December 08, 2021

Expert-verified solutions to help you succeed

b) A Deemed University conducts entrance examination for admission into its Artificial Intelligence programme. It conducts an entrance exam and assigns grades based on their scores. After registration, it wants to predict whether a student joins the program based the historical data given below No Age 1 youth 2 youth 3 middle aged high 4 senior 5

Design an online resume submission form using PHP.

Telephone connections Given A houses in the city. You have to divide these houses into B localities such that every locality has at least one house. Also, every house in a locality should have a telephone connection wire with each of the other houses in the locality. You are given integers A and B. Print the minimum and the maximum number of

Question 2 Simplify the following Boolean functions F with and without the dontcare conditions d F (A, B, C, D) Em (0, 1, 4, 7, 8, 10, 11, 12, 14), D(A, B, C, D) Em(2, 3, 6, 15) CD F(with d) AB F(without d) 00 01 A 11 10 AB 00 01 F (A, B, C, D) Em (0, 1, 4, 7, 8, 10, 11, 12, 14), D(A, B, C, D) m(2, 3, 6, 15) CD 11 00 10 01 00 D 01 11 D 10

10. Exercises A. Use NCBI BLAST to identify the following sequence Seql ATGGGTAAGGAGGACAAGACTCACCTTAACGTCGTCGTCATCGGCCACGTCGACTCTGGCAAGT CGACCACTGTAAGTACAACCAACAGCGGGTTGCTTATCTGCACTCGGAATCCGCCAAACCTGGC AGGGTATCACCAAAACATCTTGCTAACTTTTGACAGACCGGTCACTTGATCTACCAGTGCGGTG GTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTAGTCAATATCCCTTCGATTACGCGCG

1. Use mathematical induction to prove the following 1(i1)(n1)(n2) 2. As a function of n, give an exact closedform solution (no embedded sums) to the following summation f(n) t 3. Show that 373n100 is O(n) (by selecting appropriate constants c and no). 4. Prove the following by specific constants c and no f(n) n 2n80(n) 5. Prove or disprove

Q. Convert the below MANYTOMANY relationship into two ONEMANY relationships. Include business rules as well to come up intermediate entity. (3 pts) Figure Q3.18 The Crows Foot ERD for Driver and Truck DRIVER drives TRUCK During some time interval, a DRIVER can drive many TRUCKS and any TRUCK can be driven by many DRIVERS

Apply the ShannonFano Algorithm to compress the code of () and find the following questions Binary Code ShannonFano 000 0 001 010 011 Source Symbol A B D E Questions 1 Constructing the code tree 2 Compression ratio. 3 The Entropy of the source H PI logz Pi i0 4 The average length of the binary code P 0.4 Lavg 0.3 0.12 0.1 0.07 H 2.0087 Pili i0

Convert the following 1NFA into the corresponding DFA. Let I (a, b). A 2NFA M is defined as M (QM, 8M, , sM, FM), where QM is a set of state q0, q1, q2, q3, q4, a, b) is alphabet, . SM q0, which is a start state, q1), and FM . SM is transition function 1. SM (90, 2) (q1) 2. SM (q1, a) (q1, q2 3. SM (q2, b) q3 4. SM (q2, 2) q4)

Question 2 (40) Consider the following Boolean equation F(A, B, C) AC ABC BC AB a. Simplify (i.e. minimize) the function F(A,B,C) b. Build the logic circuit that represents the simplified function F (A,B,C)

1. What does physical data independence mean Give an example using SQL and explain why it is important to database systems. 2. Explain the difference between database and database management system. 3. A vehicle registration database has the following fields vin (vehicle identification number), tagnumber, make, model, year, color. Which field or

SECTION ATWO QUESTIONS COMPULSORY QUESTION 1 A. Define the following computer programming terms Program, Programming, Pseudocode, Debugging, and an Algorithm. B. Write a C Program that will print the name of your top five (5), e programming languages on five (5) separate lines using favorite a single cout statement. C. Write the C line of code

3. (20 marks) There are numbers from 1 to n in an array A. Out of these, one of the number gets duplicated and one is missing. (a) (10 marks) Design an algorithm to find out the duplicate number. For example, let n be 7 and array A be 3, 5, 2, 6, 1, 7, 6 , the answer should be 6. You have to do it in O(n) time without using any auxiliary space

QUESTION 1 (30 MARKS) Richfield College is introducing a student loans facility for students to apply for a loan and repay over a stipulated timeframe. As a junior developer you have been assigned a task to develop the following student loan repayment calculator (Figure 1), which will be included on the website. The program should use the correct

Write a program called My Calculator using SmallTalk program. Your program should be able to receive integer numbers from user. The numbers should be identified as positive or negative number. Check also if the numbers are the same or not. Then, perform all mathematical operations on the numbers. Your program must be userfriendly. Use any online

String s contains lowercase letters, digits, ( and ), satisfying the following rules Two digits cannot be adjacent. Two ( cannot be adjacent. One ( and one ) cannot be adjacent. After any digit, there must be (. The quantities of ( and ) are equal. Change string s until new string t created, t contains only lowercase letters. These are

Assignment 1 HTML CSS Overview In this assignment, you will be creating a website using proper HTML and CSS that consists of two pages minimum Make certain your site has interesting information in it that it is well organized and easy to navigate and that it is artistically pleasing. Your site should be based around a single subjectone of your

1. A search tree can be represented in LISP as follows (a) if the search tree contains a single leaf node L, it can be represented by atom L (b) if the search tree has more than one node and is rooted at N, then it can be represented by a list (S1 S2... Sk) where Si represents the ith subtree of N. Consider for example the following search trees,

USE VERILOG HDL CODE TO DESIGN THE FOLLOWING 2) DIGITAL COUNTERDECREMENTER. IF UP IS ASSERTED, THEN COUNT UP (0,1,2,3,...15, 0,1,2,3...15) IF UP IS DEASSERTED LOW, THEN DECREMENT DOWN (15,14,13,...0, 15,14,13 ....0). THE COUNTER ALSO HAS A PARALELL LOAD. INPUTS CLK, RESETL, PRESETL, LOADENA, UP, DATAIN(4 bits) OUTPUTS COUNT(4 bits)

Perform the sequential logical design of a Binary Coded Decimal (BCD 0-9-0) counter using JK flip-flops, and carry out the following process: a) Draw a state diagram corresponding to its operation. b) Write the corresponding state table indicating the current states, next states, and the corresponding values in the control inputs for state

USE VERILOG HDL CODE TO DESIGN THE FOLLOWING 3) EVEN OR ODD PARITY GENERATOR (RECOMMEND YOU USE BEHAVIORAL OR DATA FLOW) INPUTS OUTPUT DATAIN (8 BITS) GENODDPAR 1 GENERATE ODD PARITY OUT BIT 0 GENERATE EVEN PARITY OUT BIT PARITYBITOUT

Write One XML code to show a photo gallery using the ScrollView element. 1. Use TableLayout to arrange photos. 2. Use ImageView and TextView elements. The following screenshots are an example of the required app. Write an XML file to design the app as stated above. You will need to use both ScrollView and Table Layout structures to build the app.

Homework 4. Matrix Inverse Write a Python program to find the inverses of usergenerated 22 matrices. 1) Do NOT use any packages (e.g., NumPy, pandas). 2) Ask the user to enter a matrix in the nested list expression. 3) Construct and display its inverse matrix. Ignore cases where the inverse does not exist. The program should be capable of the

Hook A Arm Cable V0.15 ms 5000kg 1m Pulley 2.0m Gear box AFrame Shaft Coupling Motor Speed 1500 rpm Power 3 kW D B Trolley Frame 1.5m 2.5m E Drum, 200 mm Shaft, a Counterbalance Weight Swivel caster wheel with brake Figure 1 Portable Floor Crane,Crane powered by a 3 kw Electric Motor Motor Speed 1300 rpm Maximum Hoisting load 5 metric ton Lifting

Week 4, Graded Programming Problem 3 Long journey A tourist wants to travel around India from north to south. He has a policy that he never travels back towards the north. Write a Python function longJourney (AList) to find him a route with which he can visit the maximum number of cities according to his policy, where AList represents a graph of

Here is an example of how your application should look Edit Employees Employee First ID Name John 2 Update Employees Employee ID 3 First Name Joseph Employees Employee First ID Name Last Name Salary DOB Smith Joseph Last Name brown 10000 Wed Nov 02 1983 000000 GMT0530 (India Standard Time) Last Name brown Salary DOB Salary 20000 DOB Thu Nov 02

Timetable Survey 2. Object Diagram 3. Basic Use Case Diagram Task 2 Draw a basic class diagram for a customer ordering then paying for items on an ecommerce website. Use your personal experience to draw associations and relationships between classes. You can draw your context diagram using pen and paper or any software that you have access to,

Question in TASM Language. Your Client asked you to design, code and test a program by using Procedures that 1. Request the user to enter two numbers. Each number can be in this format xx.xx(where x is number that user enters). Thus, the following number formats are acceptable. 0.9, 1, 1.50, 10.6, 91.20, 0.7, 1.4. 2. Then, check whether the data

Question 5 (a) For each diagram below there are two sets A and B, assign element(s) of set A to B using arrows such that i. the relation is not a function ii. the relation is onetoone but not onto function iii. the relation is onto but not onetoone function iv. the relation is a bijective function v. the relation is neither onetoone nor onto A A B

Section 3 More Exercises Create a new database named as LastNameFirstName 1 create database LastNameFirstName1 7. (2 points) Use appropriate DDL to create two new tables EMP and DEPT. Please make sure to choose appropriate data type for each attribute, and also add a primary key to each table. REMINDER Dont forget to hit refresh and then double

(c) Define Security Association (SA) and explain its purpose. (d) Define Security Policy and explain its purpose with relation to IPSec. (e) What is the difference between Anonymous DiffieHellman, Ephemeral DiffieHellman, and Fixed DiffieHellman

12. Construct the logic circuit for the function AB B (C A) using ANDORNOT logic gates 13. Give a Boolean expression for the following circuit. Can you simplify your expression 00 O

Consider the data file of size 10 GB to be stored on HDFS. Assuming HDFS is having 6 data nodes, show how the data gets stored across these nodes, in terms of data blocks. (Assume Hadoop 2.X for default block size)

Assume a map reduce program for sorting operation mention what will be the input and from where it will be taken for each of these functions Mapper, Combiner and Reducer.

For doing a sort in MapReduce, describe the input to the Mapper, the output of the Reducer, and the partitioning function

Given the following data about players Rohit Sharma is a right handed opening batsman for India and Hardik Pandya is hard hitting middle order batsman with a strike rate in excess of 150 and a right arm medium fast bowler and you need to store this data in a columnar database like HBase. Design this in terms of column families and columns and

Given a table for IPL that has the following schema you need to determine the total runs scored by all the batsmen. Write MR pseudocode as a graph showing the sequence of mapreduce steps that will be used to find this You need not write actual MR code

Question Four 2 Marks Illustrate the Critical section problem And why it is problematic What are the requirements for solving the critical section problem

Question Three 2 Marks What will be the efficiency class of the exhaustive search algorithm outlined in the text for the traveling salesman problem, assuming that each tour can be generated in constant time Explain your answer.,Question Four 3 Marks Write a Brute force algorithm to find all the common elements in two lists of integer numbers.

Sort all the functions below in increasing order of asymptotic bigO growth. Question Two Given an array of integers and an integer target. Write a brute force algorithm that return true if there are two numbers in that array that sums to target. If there are no pair of numbers that sum to target, return false. Show the time complexity of the

Redraw the Binary Search Tree below after 25 is deleted. 3 12 25 29 31 35

5. a) Write a Pandas program to perform the following operations i) replace the value of 6 by 1 ii) rename the index by string values iii) write a mapping for distinct characters and display the newly created list. 01234 P62365 RPUPSC a S

Implement the following classes 1. class Course that includes two instance variables private String Name the course name private int ID the course ID Your class should have the following A constructor that initializes the two instance variables ID and Name. Set and get methods for each instance variable. toString method that returns a String

Mary has a trit j 0,1,2 and, based on j, sends a onequbit state a0B1 to John. John applies some nqubit unitary U to (a01)00...0 and performs a standard measurement to the resulting state. He obtains some x 0,1n as an outcome. John applies a function f 0,1n 0,1,2 to x to get a trit. The scheme works if only if, starting with any j 0,1,2, the

c) Given that you have the following data stored on HDFS using CSV files TaxPaid Table Name BankDetails PAN PAN Date MR Step Relational no Operational operations performed State in which tax paid Tax Paid Bank account. You need to design a Mapreduce program to compute the total tax paid per state. Which relational operations will you require to

Karl and Marta can afford 850.00 a month for mortgage payments. They can arrange a mortgage at a rate of 5.2 compounded semiannually, amortized over 25 years. Determine the amount of mortgage that Karl and Marta can get. How much interest will they pay over the life of the mortgage

improve the performance c) One of the mappers is progressing slowly. How does the Hadoop YARN framework respond to this,2. Consider that you are given a file containing the annotated form of the Ramayana which runs into 900MB as a text file. The Ramayana is broken into 7 major Kaandas (books) namely the Baala, Ayodhya, Aranya, Kishkindha, Sundara,

Consider a search problem to sort a horizontal row of tiles, where each move in the search swaps a pair of adjacent tiles. The following shows the start and end states 3 4 1 2 1 2 3 4 A move consists of swapping the position of two adjacent numbers, as shown below 3412 3421 The distance d for digit i is the number of positions it is from its goal

You should consult the slide below from lectures where we covered an example trace of standard DFS on the UCD route finding problem. Initial Queue CG Loop 1 Queue Loop 2 Queue Loop 3 Queue Loop 4 Queue Loop 5 Queue Loop 6 Queue Loop 7 Queue Loop 8 Queue Extend CG to SC Extend SC to S Extend S to SR, L, CS, W Cant extend SR M Extend L to A, SG, E,

1. For each of the C assignments shown below, show how the data is stored in little endian and bigendian format after execution. Assume every location in the memory is a byte long and int occupies 4 bytes. Clearly show all your steps. (12 Points) a. int c 0XACAFE b. int d 3239

Requirements a) Your class should be named NumberGuessingGame, and your source code file should be NumberGuessingGame.java. named b) Although you dont need to submit a pseudocode for this HW, it is always helpful to start your Java file with a pseudocode writing, that provides the program structure and blocks, and some singleline comments for the

nd Prove that for all n N, n 1 A4 2 1 Where was this used in the proof of Lemma about the binary search n 2 2 n 2

(5 points) Bubblesort is a popular but inefficient sorting algorithm. It works by repeatedly swapping adjacent elements that are out of order. Given an unsorted array A0..n1, n 2, the bubblesort algorithm is described as follows Algorithm bubbleSort (A, n) for (i 0 to n2) loop from 0 to n2. swapped false for (j 0 to n1i) if (Aj Aj1) swap

Problem 3 Controllability Gramian (a) Consider the following state equation 0.5 0 x 85 9 8. x U 0 x(0) 01 (i) (2 points) Show that there exists an input u(t) that drives x(0) to 0 in finite time. (ii) (3 points) Compute (by hand) the particular input u(t) that achieves this in 3 seconds. (iii) (3 points) Verify that the input achieves this

2. Use the NeedlemanWunsch algorithm to align the sequences GTCAGT and GTACGA with matching score 2, mismatching score 1, and gap penalty score 2. Then write all the possible optimal paths.

Assume that we have the following interindustry transaction matrix for a simple 3sector economy S1, S2 and S3 Z 350 0 0 50 250 175 200 150 550 Let us also assume that the total production of each sector is given by X 1400 1000 1100 Let us now define the matrix matrix X, such that,X 1400 1000 1100 Let us now define the matrix matrix X, such that

COPE D Quizzes Modules H9 H A 1 Home 2 Suits 3 Bunglow 4 Condo A 5 Apartments C6 Town Home 7 Home 1 8 Home 2 9 Home 3 10 Home 4 11 Home 5 12 Home 6 13 Home 7 Please complete the following tasks 1. Download the datafile for the assignment. You can access the file here 2. Using the Assignment 1 data file, please complete answer the following

SERVICE INVOICE ServiceID Service Description UnitPrice INVOICEITEM InvoiceNumber ItemNumber ServiceID InvoiceNumber CustomerID CUSTOMER CustomerID FirstName Subtotal Tax LastName Phone quantity UnitPrice TotalAmount EmailAddress ExtendedPrice Based on the above relations, create following tables (Question 1.11.4). 1.1 Create table CUSTOMER based

c) If you need to export the page rank obtained out to an SQL database after the computation, which tool would you use,3 The above graph shows the a sample of the internet of 5 pages with the edges representing the links between the pages. Express the graph as an adjacency matrix and a sparse transition matrix stored on HDFS in CSV format. If the

Project Assignment Expand your Matlab fourbar linkage simulator from project 2. To do this, create a function (fourBarSimMulti.m) for your program that has the following inputs and outputs INPUTS 11, 12, 13, 14, Tp, B, 02 start 02enda, n OUTPUTS 030, 040, 03, 04c, Pxor Pyo, Pxc, Pyc The INPUTS are defined as follows 1, the length of the ground

i) Convert the following NFA to DFA and draw the equivalent DFA diagram. 6 P q r S t 0 p,r r,s p,r 1 q p ii) Describe the language accepted by the NFA and DFA. iii) Perform string validation for the String 10001 in NFA Machine.

EXERCISE 5.4 Recommend an IDS 1. Assume you are working for a small organization that has a moderate security budget. 2. Select a particular IDS solution you would recommend for that organization. 3. Write your recommendations, including your reasons, in a memo format as if submitting them to a CIO or other decision maker.

Question 6 A function to display the make and list of models of a car manufacturer. Example Output 1 Make Toyota Model 1 Prius 2 4Runner 3 Sienna 4 Camry Example Output 2 Make Ford Model 1 Focus 2 Taurus 3 Mustang 4 Fusion 5 Fiesta

Use Boolean Algebra techniques and DeMorgans Theorem to reduce the foll to their simplest form (clearly indicate ALL steps) a) b) c) d) A (G.FF) B (K J). (K.JJ) CQP (Q P). (Q.PQ) D (Y X) (YW)

12. (0 points) Design a 4bit arithmetic combinational circuit that performs the following operations Control Inputs M Mo 0 0 0 1 1 1 0 1 if(A4 0) then S A B else S A B if(A

10. (10 points) The sevensegment indicator (see the figure below) can be used to display any one of the decimal digits 0 through 9. For example, 1 is displayed by lighting segments 2 and 3, 2 is displayed by lighting segments 1, 2, 7, 5, and 4, 8 is displayed by lighting all the seven segments. A segment is lighted when a logic 1 is applied to the

8. (5 points) Design a half adder circuit using 21 multiplexers. a. Specify the minimum number of multiplexers needed to implement the half adder. b. Build the truth table of the half adder. c. Derive the expressions of the selectors and data input lines of the used multiplexers. d. Plot the circuit.

Consider TreeDelete (page 298, and also copied below). TREEDELETE (T, z) 1 if z.left NIL 2 3 4 5 6 7 8 9 10 11 12 13 TRANSPLANT (T, z, z.right) else if z.right NIL TRANSPLANT (T, z, z.left) else y TREEMINIMUM (z.right) successor if y.p z TRANSPLANT (T, y, y.right) y.right z.right y.right.p y TRANSPLANT (T, z, y) y.left 2.left y.left.p y

Objectives Program in the C programming language Understand the lexical analysis phase of program compilation The first phase of compilation is called scanning or lexical analysis. This phase interprets the input program as a sequence of characters and produces a sequence of tokens, which will be used by the parser. Write a C program that

1 A process can be compared to the act of reading a book checked out by a student from the reserved books section of a library. (15 points) a) Program b) CPU c) PCB The student corresponds to the The book corresponds to the The library reading room corresponds to the The librarian corresponds to the d) memory The checkout record corresponds to

7) What is the maximum number of physical CPUs an application consisting of 3 processes can utilize (3 points) 8) What is the minimum number of physical CPUs an application consisting of 3 processes can utilize (3 points) 9) On how many virtual CPUs will the 3 processes run (3 points)

Son 1 There are four mineral water brands, A, B, C and D. The following table shows the mean levels for each variable, magnesium amount and potassium amount. Which is the right null hypothesis (Ho) if we want to test whether the mean potassium amount is the same for all the mineral water brands D Variable Magnesium Amount Potassium Amount A H11

In C++ Write a function that takes a string and returns the encoded string using run length encoding. In main, prompt the user for a string. the encoded string. Output the compression rate.

1. What is the output from the (unedited) C program below 5 points. f a15 b30 c35 g a15 b30 c45 main a15 b30 c35 II. Assume that C has dynamic scope (it does not) instead of static scope. What would the output be (Do this before doing part III, but you can change your answers after doing part III). 5 points. f a b g a b main a III. Modify the C

DLList Removal Description You are provided with the following DLList type object iList size of list 2 prev next sentinel nodeElement prev 241 next nodeElement Perform the following two (2) operations on iList 1. iList.remove(0) 2. iList.remove(0) prev 223 next nodeElement For each operation, you must provide three (3) separate illustrations A. An

GANT ROUND ROBIN process arrival service number time time P1 0 11 5 10 13 9 P2 P3 P4 P5 20 27 8 7 TQ5 0 waiting time 0 Given the following conditions the value of counting semaphore S at time to is 0 the process running at time 29 will execute a wait(S) the process running at time 32 will execute a signal(S) 0 response time 0 0 total time 0

3. Consider the relational schema R ( K, J, L, M, N, O, P ) and the set of functional dependencies F JL, KJ. L is a candidate key for R. Decompose R until it is in BCNF.

QUESTION 4 Given is the following NFA with three states 1, 2, and 3. Start 1 2 Final 3 a 2 O In the context of converting this NFA to DFA, the resulting DFA has start state (1) True False eweo ee 1

QUESTION 3 Given is the following NFA with three states 1, 2, and 3. ja Start 1 2 Final 31 2 O o b 6 3 O In the context of converting this NFA to DFA (transition table Tp), the AClosure of (1,3) is (1,2,3) True False O 4 1

Exercise 6.1 Configuring Memory on Paper Objective a computer is not performing as well as it used to. Windows 10 tool would the technician get the user to open to quickly tell how much RAM is currently being used by the open applications Performance Monitor Device Manager System Information Tool Task Manager Exercises Parts Procedure 2. 3.

1. Objectives To design and verify a simple RISC processor in Verilog 2. Processor Specifications 1. The instruction size is 32 bits 2. 32 32bit generalpurpose registers from RO to R31. 3. A special purpose register for the program counter (PC) 4. It has a stack called control stack which saves the return addresses 5. Stack pointer (SP), another

1. Write the pseudocode for the following problem. Ask the user for number of people For each person, ask for the name and age in years and store the data in 2 arrays. Display the heading Age Report Display the name and the age one line at a time for everyone For each person, calculate age in days and store in another array. Assume 365 days

Group Project. Imagine that there are n students in CMPSC 465, ranked from 1 to n by how comfortable they are with the course material, with 1 being the most comfortable. For the sake of this problem, a project has just been assigned that may be completed in pairs. Every student has a set of friends in the class, though these friendships may not

In this exercise, you will make the following modifications to the dice game from exercise 2 Prompt the user for the number of rounds they want to play. Code a loop to play the user entered number of rounds. Keep score for the player and computer. At the end, display who won the game after all rounds have been played (player, computer or tie).

Identify the valid redblack tree. a) Answer 8 6 8 1 10 13 OO 13 15 14 A D 14 17 17 b) 8 13 15 14 17 HUNDFUNK HORSCHUNG the c) 10 13 14 15 17 d)

Please explain each step typed out 6. Write a complete running equivalent MIPS programs for the following C program Program description Find the length of a String and the array starting address 1. include 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. int main () 13. 14. ) Char array of size 100 can hold a string of 100 chars char str100 char i Thank

Write the algorithm i. Write a code in Octave that implements Newtons method (commenting throughout your code to briefly explain what is being done) Implement the algorithm ii. i. Use your algorithm to solve Exercise 1 (d, e) of the textbook on page 77. Use your algorithm to approximate 2 with an error tolerance of 1010. How many iterations were

(1 point) This question concerns the field GF(16). The modulus is P(x) x x 1. Please answer the following questions about arithmetic in this field. a) If p(x) x 1 and q(x) x, what is p(x) q(x) modulo P b) If p(x) x and q(x) x x x, what is p(x) q(x) modulo P c) If p(x) x x and q(x) x x x 1, what is p(x) q(x) modulo P d) If p(x)

Initial Population Generation 1 Generation 2 Lab Genetic Algorithms Instructions Creating the Initial Population The initial population was created using a random bit string generator. This step is already done. Step1 Fitness function Assign each chromosome a fitness score. For example the number of black genes Step2 Selection Elitist Selection of

Write the C code to make the half adder below. PVQ OR AND NOT (PvQ) (PQ) Class HalfAdder Functions Sum, Carry (PQ) Class Gate Functions AND, OR, Negation AND Sum Carry P 1 1 0 0 Q 1 0 1 0 Carry 1 0 0 0 Sum 0 1 1 0, Write the C code to make the half adder below. PVQ OR AND NOT (PvQ) (PQ) Class HalfAdder Functions Sum, Carry (PQ) Class Gate

1. Write a SELECT that returns CustomerID. Company Name CustLastName and Phone of each customer with no orders. Paste below the code you wrote and the run results you obtained for exercise 1 2. Write a SELECT that returns the EmployeeID. LastName, FirstName, and JobTitle of any employee that has packed orders. Paste below the code you wrote and

Homework 4 1. Load the word Washington at 8kHz sampling rate. a) Estimate the autocorrelation values rx0, ..., Ix10 from a portion of the first recording b) Design a 10th order LMMSE predictor for a part of the signal. c) Estimate the pitch value using the autocorrelation method. d) Generate speech using a pulse train and the vocal tract model

2. Generate and plot an 2 cos(0.2mn) for 0 n 99 using the following MATLAB code clear all n 099 x2 cos (0.2pi. n) stem (n, x) legend (x n ) title (Sequence of periodic signal) xlabel(n) ylabel(xn) axis (0 99 2 2) Examine the operation of each command line. Then answer the following (b) (a) How many periods of the sinusoidal sequence are there in

7. Let an and yn be the input and output of a discretetime system, respectively, and they are related by yn ayn1 an. Suppose rn un which is the unit step function and y1 0. Answer the following (a) (b) Use MATLAB to generate and plot yn for 0 n 100 with a 0.5. What is the value of y10 Do you think that the system is stable Why Use MATLAB to

3.2 Your are required to create an email signup form (using HTML CSS) for Richfield students, use JavaScript to perform form validation for all the fields. (20) See image below Sign up for school email account Name Email Retype email Create a password Retype password By signing up for this account you agree to our Terms of Service and Privacy

4. Decision Tree Consider the hypothesis space defined over these instances, in which each hypothesis is represented by a pair of 5tuples. Please provide a hand trace of the ID3 algorithm to build a Decision Tree Classifier. Just show the root node, not the whole tree. D DI D2 D3 D4 D5 Outlook Sunny Overcast Rain Sunny Rain Temperature Hot Hot Hot

(20 pts.) Topological Sort. Run the DFSbased topological ordering algorithm on the following graph. Whenever you have a choice of vertices to explore, always pick the one that is alphabetically first. A B C D E F G (c) What topological ordering is found by the algorithm (d) How many topological orderings does this graph have Why H (a) Indicate the

You are given a cell image cell.jpg. Your task is to segment the cell in the center of the image, i.e get a mask of the center cell. To achieve this goal, you may do the following 1. Convert the image to a binary black and white image using thresholding. The given image is a color image, you may convert the image to a gray scale image or choose

Do database design for a store like Costco or Sams club. It must include the following phases 1.Domain documents description of domain activities. 2.List major verbsverb phases and major nounsnoun phrases. 3 Draw Entityrelationship diagram(s) with entities and relationships. Then fill in attributes(derived from minor nounsnoun phrases)

NACLS Submit Configure NACLs to control the access to the VMs according to the following Allow the administrator to access all the VMs via SSH. Submit Allow pinging from VM1 only to either VM2 or VM3. Allow VM1 to curl the webservers in the containers. Security Groups The command curl is a tool to test the functioning of webservers since the VM do

Services

Sitemap
Fun
Definitions
Become Tutor
Used Textbooks
Study Help Categories
Recent Questions
Expert Questions
Campus Wear
Sell Your Books

Company Info

Security
Copyrights
Privacy Policy
Terms & Conditions
SolutionInn Fee
Scholarship
Online Quiz
Give Feedback, Get Rewards

Get In Touch

About Us
Contact Us
Career
Jobs
FAQ
Student Discount
Campus Ambassador

Secure Payment

Download Our App

© 2026 SolutionInn. All Rights Reserved